// Viral RNA showcase — not a locked-benchmark cell

Druggability extends beyond riboswitches to pre-organized viral RNA elements — this is the evidence. The binding site here is mapped by sequence alignment from a different PDB entry (3TZR, a 2-strand crystallization construct carrying the ligand) onto the folded target (1P5M, the apo NMR structure) — not a same-structure co-crystal like the seven riboswitch targets on the locked benchmark. A whole-structure 3D overlay (like the FMN apo→holo demo) isn’t valid here — 3TZR splits the hairpin into two separate strands for crystallization, a different topology from the continuous predicted fold. The ligand toggle below instead uses a local superposition, fit only on the residues that align unambiguously between the two structures (fit RMSD 5.3 Å across 30 residues) — clearly labelled as approximate, not a validated co-crystal placement. The mapped binding-site residues are also shown in the sequence block below either way.

Example output — non-customer demo

RNA pocket discovery

HCV IRES domain IIa · 1P5M

Bound by a small-molecule HCV IRES domain IIa binder, chromeno-imidazole class (PDB ligand code SS0; verified via the RCSB chemical component dictionary) (PDB ligand SS0). 55 nt RNA target.

v0.2 scope: cleft-binding RNA ≤500 nt|Pre-pilot screen: PASS
Sequence length
55 nt
Conformers sampled
5
Structure pLDDT (mean)
0.812
Pocket clusters
3 / 6
passing persistence floor
HCV IRES domain IIa predicted structure with top-3 candidate pockets highlighted
Predicted structure, top-3 pockets highlighted.Rank 1Rank 2Rank 3

Top-3 candidate pockets

ranked by persistence × binding-residue stability
#1Cluster 1persistence 100%
Geom. score
7.00
persistence × intersected
Residues (∩)
7
every frame
Residues (∪)
10
union, all frames
residues (union): 10, 11, 12, 13, 15, 16, 43, 45, 46, 47
residues (∩ all frames): 10, 11, 12, 15, 43, 46, 47
benchmark8/10 binding-site residues (80%) — strict recovery
#2Cluster 0persistence 100%
Geom. score
6.00
persistence × intersected
Residues (∩)
6
every frame
Residues (∪)
12
union, all frames
residues (union): 13, 14, 15, 16, 17, 18, 41, 42, 43, 44, 45, 46
residues (∩ all frames): 13, 14, 16, 42, 43, 44
benchmark7/10 binding-site residues (70%) — strict recovery
#3Cluster 4persistence 40%
Geom. score
1.60
persistence × intersected
Residues (∩)
4
every frame
Residues (∪)
5
union, all frames
residues (union): 29, 30, 31, 32, 33
residues (∩ all frames): 29, 30, 31, 32
benchmark0/10 binding-site residues (0%)
Rotate the structure yourself

Cartoon backbone of the predicted reference frame. Top-3 pocket residues highlighted as licorice; centroid spheres mark each cluster's geometric centre across the ensemble. Hover a card to isolate that pocket. Toggle the ligand overlay — approximate, not a co-crystal placement: mapped from a different crystallization construct via local superposition on the sequence-aligned region only, not a whole-structure fit. See the caveat below for the fit quality.

Sequence with pocket residues highlighted

GGCUGUGAGGAACUACUGUCUUCACGCCUUCGGGAGUGUCGUGCAGCCUCCAGCC
Rank 1 pocket residuesRank 2 pocket residuesRank 3 pocket residuesknown binding-site residue

Methods summary

v0.2 detects cavities on the predicted 3D structure using RNA-tuned fpocket parameters (consistent with the published fpocketR approach, Veenbaas et al. PNAS 2025), samples a 5-frame ANM conformational ensemble, and ranks pockets by structural persistence weighted by binding-residue stability (score = persistence × n_residues_intersected). The cross-frame geometric ranker is the load-bearing contribution: on a 7-target cleft-binder benchmark, RNA-tuned detection alone recovers 0 of 7 at strict@1; the ensemble + ranker lifts recovery to 3 of 7 strict@1 and 6 of 7 near@1. Druggability assessment itself is left to your medicinal-chemistry workflow; we provide the geometric metadata and conformational stability metrics as inputs to it. Computational predictions only — experimental validation is required before use in drug development.

Read full methodology →

Binding-mode caveat

Pipeline detects cleft-shaped binding pockets. Groove-binding modes and shallow surface-deformation binding may be missed. Contact us if your target's binding mode is groove-mediated.

Computational predictions only. Experimental validation required before drug-development use.

// How to read this result

  • This is a cross-referenced showcase, not a ranking benchmark. The locked rank-1 benchmark (seven riboswitch targets, same-structure co-crystals) lives on the methodology page.
  • The structures. Folded target: PDB 1P5M (apo NMR, chain A, 55 nt). Ligand site source: PDB 3TZR (2-strand crystallization construct carrying ligand SS0, a chromeno-imidazole HCV IRES IIa binder). The binding-site residues are mapped onto 1P5M by sequence alignment (longest-common-substring) — the same method used for the locked benchmark’s peptide- and literature-derived sites.
  • The 3D ligand overlay is an approximation, not a co-crystal placement. 3TZR’s two-strand construct has a different global topology from the continuous predicted fold, so a whole-structure superposition isn’t valid. The toggle instead uses a local Kabsch fit restricted to the 30 residues that align unambiguously between the two structures (fit RMSD 5.3 Å) — stated explicitly every place the overlay appears. As an independent sanity check, not a hidden assumption: the placed ligand’s nearest atom lands 3.3 Å from the pipeline’s independently-detected rank-1 pocket, consistent with the strict@1 result below.
  • Pipeline unchanged. Same single-sequence RhoFold + 5-frame ANM ensemble + geometric ranker as every other worked example — no target-specific tuning.

All worked examples →