// Single-seq arm · near@1 · scope-honest

Global RMSD looks bad. The local pocket geometry recovers anyway.

On 5C45 the predicted structure’s C3′ backbone RMSD against the deposited co-crystal is 10.2 Å — by global-fold standards, poor. The rank-1 cluster nonetheless picks up 40% of the experimental FMN binding-site residues: above the 30% near@1threshold, below the 50% strict@1 threshold. The pre-pilot screen excludes MSA (min_id 0.808, no diverse-tail homologs); single-sequence is the as-shipped arm.

Why this case ships as a worked example rather than as a footnote: backbone RMSD is the wrong customer-facing quality metric on RNA. What matters is whether the cluster geometry overlaps the binding site. 5C45 is the canonical case where the two measures disagree, and we report both so the customer can see the gap.

RMSD
10.2 Å
backbone
overlap
40%
rank-1
verdict
near@1
not strict

Numbers from locked v0.2 benchmark ·  strict@K / near@K definitions

Example output — non-customer demo

RNA pocket discovery

FMN riboswitch · 5C45

Bound by flavin mononucleotide (family ligand; 5C45 co-crystal binds the designed analog 51B) (PDB ligand FMN). 54 nt RNA target.

v0.2 scope: cleft-binding RNA ≤500 nt|Pre-pilot screen: PASS
// pre-pilot screenPASSsingle-seq armmin_id 0.808 · 0.0% homologs at 70–80% identityAbove min_id threshold and no diverse tail — MSA correctly excluded
Sequence length
54 nt
Conformers sampled
5
Structure pLDDT (mean)
0.754
Pocket clusters
3 / 6
passing persistence floor
FMN riboswitch predicted structure with top-3 candidate pockets highlighted
Predicted structure, top-3 pockets highlighted.Rank 1Rank 2Rank 3

Top-3 candidate pockets

ranked by persistence × binding-residue stability
#1Cluster 0persistence 100%
Geom. score
5.00
persistence × intersected
Residues (∩)
5
every frame
Residues (∪)
10
union, all frames
residues (union): 9, 10, 11, 31, 32, 33, 34, 35, 41, 42
residues (∩ all frames): 9, 10, 32, 33, 41
benchmark2/5 binding-site residues (40%) — near recovery
#2Cluster 2persistence 40%
Geom. score
2.00
persistence × intersected
Residues (∩)
5
every frame
Residues (∪)
6
union, all frames
residues (union): 10, 11, 12, 29, 30, 31
residues (∩ all frames): 10, 11, 12, 30, 31
benchmark2/5 binding-site residues (40%) — near recovery
#3Cluster 1persistence 40%
Geom. score
1.60
persistence × intersected
Residues (∩)
4
every frame
Residues (∪)
5
union, all frames
residues (union): 18, 19, 21, 22, 24
residues (∩ all frames): 18, 21, 22, 24
benchmark0/5 binding-site residues (0%)
Rotate the structure yourself

Cartoon backbone of the predicted reference frame. Top-3 pocket residues highlighted as licorice; centroid spheres mark each cluster's geometric centre across the ensemble. Hover a card to isolate that pocket. Toggle the experimental FMN overlay to see where the co-crystal ligand sits relative to the rank-1 cluster.

Sequence with pocket residues highlighted

GGAUCUUCGGGGCAGGGUGAAAUUCCCGACCGGUGGUAUAGUCCACGAAAGCUU
Rank 1 pocket residuesRank 2 pocket residuesRank 3 pocket residuesknown binding-site residue

Methods summary

v0.2 detects cavities on the predicted 3D structure using RNA-tuned fpocket parameters (consistent with the published fpocketR approach, Veenbaas et al. PNAS 2025), samples a 5-frame ANM conformational ensemble, and ranks pockets by structural persistence weighted by binding-residue stability (score = persistence × n_residues_intersected). The cross-frame geometric ranker is the load-bearing contribution: on a 7-target cleft-binder benchmark, RNA-tuned detection alone recovers 0 of 7 at strict@1; the ensemble + ranker lifts recovery to 3 of 7 strict@1 and 6 of 7 near@1. Druggability assessment itself is left to your medicinal-chemistry workflow; we provide the geometric metadata and conformational stability metrics as inputs to it. Computational predictions only — experimental validation is required before use in drug development.

// rank-1 binding-site overlap, this target

fpocketR single-frame
40%NEAR
→
v0.2 ensemble + ranker
40%NEAR

flat · already NEAR at single-frame detection

Read full methodology →

Binding-mode caveat

Pipeline detects cleft-shaped binding pockets. Groove-binding modes and shallow surface-deformation binding may be missed. Contact us if your target's binding mode is groove-mediated.

Computational predictions only. Experimental validation required before drug-development use.