// MSA path · longest target · pre-pilot screen passed

161 nucleotides, deep MSA — the opt-in path produces near@1 where single-seq fails.

4GXY is the longest target in the v0.2 benchmark and the only one that triggers the screen on both criteria (min_id 0.705 AND 29.5% homologs in the diverse 70–80% identity band). Single-sequence prediction lands a rank-1 cluster at 18% overlap — neither strict nor near. The MSA-driven path lifts it to 35% overlap: NEAR@1.

4GXY pairs with 4LVV (THF, 50% STRICT under MSA) to define the empirical range over which the opt-in MSA path adds value. Both targets fail single-seq, both pass MSA; the headline numbers span the strict/near boundary.

single-seq
18%
neither
MSA path
35%
near@1

Numbers from locked v0.2 benchmark ·  screen methodology

Example output — non-customer demo

RNA pocket discovery

B12 riboswitch · 4GXY

Bound by cobalamin (family ligand; 4GXY co-crystal binds the designed analog B1Z) (PDB ligand B12). 161 nt RNA target.

v0.2 scope: cleft-binding RNA ≤500 nt|Pre-pilot screen: PASS
// pre-pilot screenPASSMSA armmin_id 0.705 · 29.5% homologs at 70–80% identityTriggers on both criteria — longest target in benchmark, deep MSA available
Sequence length
161 nt
Conformers sampled
5
Structure pLDDT (mean)
0.751
Pocket clusters
12 / 16
passing persistence floor
B12 riboswitch predicted structure with top-3 candidate pockets highlighted
Predicted structure, top-3 pockets highlighted.Rank 1Rank 2Rank 3

Top-3 candidate pockets

ranked by persistence × binding-residue stability
#1Cluster 1persistence 100%
Geom. score
12.00
persistence × intersected
Residues (∩)
12
every frame
Residues (∪)
12
union, all frames
residues (union): 66, 67, 68, 99, 100, 101, 112, 113, 114, 145, 146, 147
residues (∩ all frames): 66, 67, 68, 99, 100, 101, 112, 113, 114, 145, 146, 147
benchmark6/17 binding-site residues (35%) — near recovery
#2Cluster 4persistence 100%
Geom. score
9.00
persistence × intersected
Residues (∩)
9
every frame
Residues (∪)
15
union, all frames
residues (union): 35, 36, 37, 65, 66, 67, 68, 69, 140, 141, 142, 143, 144, 145, 146
residues (∩ all frames): 66, 67, 68, 69, 140, 141, 142, 143, 144
benchmark6/17 binding-site residues (35%) — near recovery
#3Cluster 5persistence 100%
Geom. score
5.00
persistence × intersected
Residues (∩)
5
every frame
Residues (∪)
9
union, all frames
residues (union): 95, 96, 97, 98, 112, 113, 114, 116, 117
residues (∩ all frames): 95, 96, 97, 112, 113
benchmark1/17 binding-site residues (6%)
Rotate the structure yourself

Cartoon backbone of the predicted reference frame. Top-3 pocket residues highlighted as licorice; centroid spheres mark each cluster's geometric centre across the ensemble. Hover a card to isolate that pocket. Toggle the experimental B12 overlay to see where the co-crystal ligand sits relative to the rank-1 cluster.

Sequence with pocket residues highlighted

GCGGCAGGUGCUCCCGACGUCGGGAGUUAAAAGGGAAGCCGGUGCAAGUCCGGCACGGUCCCGCCACUGUGACGGGGAGUCGCCCCUCGGGAUGUGCCACUGGCCCGGCCGGGAAGGCGGAGGGGCGGCGAGGAUCCGGAGUCAGGAAACCUGCCUGCCGU
Rank 1 pocket residuesRank 2 pocket residuesRank 3 pocket residuesknown binding-site residue

Methods summary

v0.2 detects cavities on the predicted 3D structure using RNA-tuned fpocket parameters (consistent with the published fpocketR approach, Veenbaas et al. PNAS 2025), samples a 5-frame ANM conformational ensemble, and ranks pockets by structural persistence weighted by binding-residue stability (score = persistence × n_residues_intersected). The cross-frame geometric ranker is the load-bearing contribution: on a 7-target cleft-binder benchmark, RNA-tuned detection alone recovers 0 of 7 at strict@1; the ensemble + ranker lifts recovery to 3 of 7 strict@1 and 6 of 7 near@1. Druggability assessment itself is left to your medicinal-chemistry workflow; we provide the geometric metadata and conformational stability metrics as inputs to it. Computational predictions only — experimental validation is required before use in drug development.

// rank-1 binding-site overlap, this target

fpocketR single-frame
0%NEITHER
→
v0.2 ensemble + ranker
35%NEAR

+35 pp · NEITHER → NEAR

Read full methodology →

Binding-mode caveat

Pipeline detects cleft-shaped binding pockets. Groove-binding modes and shallow surface-deformation binding may be missed. Contact us if your target's binding mode is groove-mediated.

Computational predictions only. Experimental validation required before drug-development use.