Example output — non-customer demo

RNA pocket discovery

TPP riboswitch · 2GDI

Bound by thiamine pyrophosphate (PDB ligand TPP). 78 nt RNA target.

v0.2 scope: cleft-binding RNA ≤500 nt|Pre-pilot screen: PASS
// pre-pilot screenPASSsingle-seq armmin_id 0.761 · 0.0% homologs at 70–80% identityNo diverse-tail homologs — single-seq prediction is the appropriate arm
Sequence length
78 nt
Conformers sampled
5
Structure pLDDT (mean)
0.729
Pocket clusters
8 / 12
passing persistence floor
TPP riboswitch predicted structure with top-3 candidate pockets highlighted
Predicted structure, top-3 pockets highlighted.Rank 1Rank 2Rank 3

Top-3 candidate pockets

ranked by persistence × binding-residue stability
#1Cluster 0persistence 100%
Geom. score
5.00
persistence × intersected
Residues (∩)
5
every frame
Residues (∪)
10
union, all frames
residues (union): 9, 10, 29, 30, 32, 33, 47, 62, 63, 64
residues (∩ all frames): 9, 10, 30, 32, 33
benchmark10/14 binding-site residues (71%) — strict recovery
#2Cluster 8persistence 40%
Geom. score
4.40
persistence × intersected
Residues (∩)
11
every frame
Residues (∪)
14
union, all frames
residues (union): 11, 12, 13, 27, 28, 29, 33, 57, 58, 59, 60, 61, 62, 63
residues (∩ all frames): 11, 12, 28, 29, 33, 57, 58, 60, 61, 62, 63
benchmark4/14 binding-site residues (29%)
#3Cluster 2persistence 80%
Geom. score
4.00
persistence × intersected
Residues (∩)
5
every frame
Residues (∪)
10
union, all frames
residues (union): 40, 41, 42, 43, 44, 45, 46, 73, 74, 75
residues (∩ all frames): 41, 42, 43, 73, 74
benchmark0/14 binding-site residues (0%)
Rotate the structure yourself

Cartoon backbone of the predicted reference frame. Top-3 pocket residues highlighted as licorice; centroid spheres mark each cluster's geometric centre across the ensemble. Hover a card to isolate that pocket. Toggle the experimental TPP overlay to see where the co-crystal ligand sits relative to the rank-1 cluster.

Sequence with pocket residues highlighted

GACUCGGGGUGCCCUUCUGCGUGAAGGCUGAGAAAUACCCGUAUCACCUGAUCUGGAUAAUGCCAGCGUAGGGAAGUU
Rank 1 pocket residuesRank 2 pocket residuesRank 3 pocket residuesknown binding-site residue

Methods summary

v0.2 detects cavities on the predicted 3D structure using RNA-tuned fpocket parameters (consistent with the published fpocketR approach, Veenbaas et al. PNAS 2025), samples a 5-frame ANM conformational ensemble, and ranks pockets by structural persistence weighted by binding-residue stability (score = persistence × n_residues_intersected). The cross-frame geometric ranker is the load-bearing contribution: on a 7-target cleft-binder benchmark, RNA-tuned detection alone recovers 0 of 7 at strict@1; the ensemble + ranker lifts recovery to 3 of 7 strict@1 and 6 of 7 near@1. Druggability assessment itself is left to your medicinal-chemistry workflow; we provide the geometric metadata and conformational stability metrics as inputs to it. Computational predictions only — experimental validation is required before use in drug development.

// rank-1 binding-site overlap, this target

fpocketR single-frame
43%NEAR
→
v0.2 ensemble + ranker
71%STRICT

+28 pp · NEAR → STRICT

Read full methodology →

Binding-mode caveat

Pipeline detects cleft-shaped binding pockets. Groove-binding modes and shallow surface-deformation binding may be missed. Contact us if your target's binding mode is groove-mediated.

Computational predictions only. Experimental validation required before drug-development use.