// Golden target · RNA pipeline, evidence layer

HCV IRES IIa

55 nt · predicted structure regenerated live for this page (same single-sequence RhoFold + ANM ensemble + fpocket + ranker pipeline as every worked example on this site).

Rank 1 Rank 2 Rank 3

// Sequence

GGCUGUGAGGAACUACUGUCUUCACGCCUUCGGGAGUGUCGUGCAGCCUCCAGCC
Length55 nt
Mean pLDDT0.8124
Pocket clusters3

// Findings

Family, precedent, and provenance

Family classification

returned data

IRES_HCV (RF00061) — Hepatitis C virus internal ribosome entry site

E=4.90e-9 · bit score 32.9 · passes full-length threshold: no

hit is statistically significant (E=4.9e-09) but scores below the family's own curated full-length gathering threshold (bit_score=32.9 < GA=290.0) — consistent with a partial/sub-domain match rather than a full-length family member

Known ligand precedent

returned data

0 HARIBOSS-curated · 9 broader RCSB structures

  • 1F84 — (none recorded)
  • 2AGN — (none recorded)
  • 1FQZ — (none recorded)
  • 1KH6 — (none recorded)
  • 1P5M — (none recorded)

Conservation

returned data

51 seed sequences · mean pairwise identity 86.7%

Similar known RNAs

returned data
  • 1P5M — 100.0% identity · (none)
  • 1P5O — 53.9% identity · (none)
  • 1KH6 — 44.5% identity · (none)
  • 1P5N — 24.5% identity · (none)
  • 3T4B — 19.6% identity · (none)

Structure-based: not applicable. Foldseek does not support nucleic-acid structures — its 3Di structural alphabet is protein-specific. Confirmed by testing against the FMN riboswitch golden target (PDB 5C45): querying with an all-RNA structure produces no queryable representation in Foldseek's own database, not merely zero hits. This is a permanent tool limitation for this phase, not a missing computation.

Interaction fingerprints (Evidence Integration Layer)

no_ligand_bound_structure

8 ligand-bound structure(s) exist for this target's Rfam family (RF00061), but none checked matched the query at >=85% sequence identity — likely other members of the same family, not this specific sequence. Interaction fingerprints require a structure of the query sequence itself.

Structural analysis — ranked pocket clusters

returned data
RankPersistenceResidues
#1110, 11, 12, 13, 15, 16, 43, 45, 46, 47
#2113, 14, 15, 16, 17, 18, 41, 42, 43, 44, 45, 46
#30.429, 30, 31, 32, 33

// Limitations & data provenance

Auto-populated from each section’s own status — not hand-maintained.

Family classificationreturned data
Known ligand precedentreturned data
Interaction fingerprintsno_ligand_bound_structure
Conservationreturned data
Structural analysisreturned data
Similar known RNAsreturned data
Download PDF report← All demos