// Golden target · RNA pipeline, evidence layer

FMN riboswitch (5C45)

54 nt · predicted structure regenerated live for this page (same single-sequence RhoFold + ANM ensemble + fpocket + ranker pipeline as every worked example on this site).

Rank 1 Rank 2 Rank 3

// Sequence

GGAUCUUCGGGGCAGGGUGAAAUUCCCGACCGGUGGUAUAGUCCACGAAAGCUU
Length54 nt
Mean pLDDT0.7537
Pocket clusters3

// Findings

Family, precedent, and provenance

Family classification

returned data

FMN (RF00050) — FMN riboswitch aptamer (RFN element)

E=4.60e-9 · bit score 41.3 · passes full-length threshold: no

hit is statistically significant (E=4.6e-09) but scores below the family's own curated full-length gathering threshold (bit_score=41.3 < GA=66.2) — consistent with a partial/sub-domain match rather than a full-length family member

Known ligand precedent

returned data

19 HARIBOSS-curated · 19 broader RCSB structures

  • 2YIEFMN, GZ7
  • 2YIFFMN, GZ7
  • 6DN1FMN, GZ7
  • 3F2QFMN
  • 3F2TFMN

Conservation

returned data

146 seed sequences · mean pairwise identity 61.5%

Similar known RNAs

returned data
  • 3F4E100.0% identity · 51B, 6YG, DKM, FMN, GZ4, GZG, RBF, RS3
  • 2YIE94.4% identity · FMN, GZ7
  • 2YIF46.5% identity · FMN, GZ7
  • 3F4G46.4% identity · 51B, 6YG, DKM, FMN, GZ4, GZG, RBF, RS3
  • 3F2Q21.4% identity · FMN

Structure-based: not applicable. Foldseek does not support nucleic-acid structures — its 3Di structural alphabet is protein-specific. Confirmed by testing against the FMN riboswitch golden target (PDB 5C45): querying with an all-RNA structure produces no queryable representation in Foldseek's own database, not merely zero hits. This is a permanent tool limitation for this phase, not a missing computation.

Interaction fingerprints (Evidence Integration Layer)

returned data

Representative complex: 2YIE (FMN, 2.94 Å)

Residue (PDB)Residue (pipeline)InteractionPartner
4848hydrogen bondA48 (hydrogen bond) with ligand FMN
84?hydrogen bondG84 (hydrogen bond) with ligand FMN
99?hydrogen bondA99 (hydrogen bond) with ligand FMN
4848hydrogen bondA48 (hydrogen bond) with ligand FMN
99?hydrogen bondA99 (hydrogen bond) with ligand FMN
1111hydrogen bondG11 (hydrogen bond) with ligand FMN
1010hydrogen bondG10 (hydrogen bond) with ligand FMN
62?hydrogen bondG62 (hydrogen bond) with ligand FMN
62?hydrogen bondG62 (hydrogen bond) with ligand FMN
3232hydrogen bondG32 (hydrogen bond) with ligand FMN
84?hydrogen bondG84 (hydrogen bond) with ligand FMN
1010hydrogen bondG10 (hydrogen bond) with ligand FMN
1111hydrogen bondG11 (hydrogen bond) with ligand FMN
85?pi stackingA85 (pi stacking) with ligand FMN
85?pi stackingA85 (pi stacking) with ligand FMN
85?pi stackingA85 (pi stacking) with ligand FMN
85?pi stackingA85 (pi stacking) with ligand FMN
4848pi stackingA48 (pi stacking) with ligand FMN

Representative complex: 3F4E (51B, 3.05 Å)

ligand 51B not found as an analyzable PLIP binding site in this structure

1/2 representative structure(s) produced interaction data

Structural analysis — ranked pocket clusters

returned data
RankPersistenceResidues
#119, 10, 11, 31, 32, 33, 34, 35, 41, 42
#20.410, 11, 12, 29, 30, 31
#30.418, 19, 21, 22, 24

Pocket residues overlapping known interaction sites

  • Pocket 1: residues 10, 11, 32 (3 of 10 pocket residues match a known interaction site)
  • Pocket 2: residues 10, 11 (2 of 6 pocket residues match a known interaction site)
  • Pocket 3: no overlap with known interaction sites (5 checked)

// Limitations & data provenance

Auto-populated from each section’s own status — not hand-maintained.

Family classificationreturned data
Known ligand precedentreturned data
Interaction fingerprintsreturned data
Conservationreturned data
Structural analysisreturned data
Similar known RNAsreturned data